Buy Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Book 1
Book 2
Book 3
Book 1
Book 2
Book 3
Book 1
Book 2
Book 3
Book 1
Book 2
Book 3
Home > Mathematics and Science Textbooks > Biology, life sciences > Microbiology (non-medical) > Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation: (34 Nato ASI Subseries H:)
37%
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation: (34 Nato ASI Subseries H:)

Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation: (34 Nato ASI Subseries H:)


     0     
5
4
3
2
1



Available


X
About the Book

Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa- tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 * -96 -84 GGAGATTCCCC IL-2R (p55) ...

Table of Contents:
Why a Workshop on Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation.- Using Embryonal Stem Cells to Introduce Mutations into the Mouse Germ Line.- New Strategies in Developmental Biology: In Vivo Mutagenesis as a Tool to Dissect Mammalian Development.- Visualization by nlsLacZ of Gene Activity during Mouse Embryogenesis.- The Albino Perinatal Lethal Mutation: Identification of Affected mRNAs and Mapping of the Locus by Pulsed-Field Gel Electrophoresis.- Mutations in Transgenic Mice.- Effects of Provirus Insertion on Expression of ?1(I) Collagen Gene in Mov13 Mice.- Cellular Target Sequences for Retrovirus Integration.- Identification of Retroviral Sequences Involved in the Inactivation of the Viral Genome in Embryonal Carcinoma Cells.- Strand Switching during Retroviral Reverse Transcription.- Do Retroviuses Contribute to the Genesis of Intron-less Pseudogenes?.- Biological Activities of Mouse Retrotransposons MURRS/LTR-IS.- Retroviral Receptors and Interference on Human Cells.- Cell Targeting by Recombinant Retroviruses Using Bi-specific Antibody Complexes.- Improvement of Gene Expression and Virus Production in the Use of Retroviral Vectors for Gene Transfer.- New Retroviral Models for Gene Therapy: Swords into Plowshares.- Hemopoietic Regulation Assessed in Clonal Culture: A Brief Overview.- Haemopoietic Cells as Targets for Gene Transfer.- Human (3-globin Expression in Murine Bone Marrow Transplant Recipients Reconstituted with Retrovirally Transduced Stem Cells.- Genetic Manipulation of Human Hematopoietic Stem Cells.- The Role of Cytokines in the Normal and Abnormal Growth of Hemopoietic Cells.- Tumor Necrosis Factor and Interleukin-6: Structure and Mechanism of Action of the Molecular, Cellular and In Vivo Level.- UnexpectedBiological Effects of the Deregulated IL-2/IL-2 Receptor System on the Lymphocyte Development.- T Cell Activation Signals and Regulation of Lymphokine Gene by Viral and Cellular Transactivators.- Lymphoid VDJ Recombinase Activity: Development of a Novel Fluorescence- based Assay System.- Meiotic Copy Number Changes at CUPT are Mediated by Gene Conversion.- Epstein-Barr Virus Gene Expression in Normal and Malignant B Cells: Implications for the Immune T Cell Control of EBV Infection.- Suppression of Cellular Gene Activity in Adenovirus-transformed Cells.- Dysregulated Activation of a Haemopoietic Growth Factor Gene alone is Insufficient to Cause Malignent Haemopoietic Disease in Normal Haemopoietic Cells.- Mechanisms of IL-3 Regulated Growth and Transformation of Hematopoietic Cells.- Synergism between Oncogenes in T-cell Lymphogenesis.- The Mouse jun Family.- The c-jun Gene and Its Role in Signal Transduction.- Two Nuclear Oncogene Products Cooperate in the Formation of the Transcription Factor AP-1.- p53: Onco - or Anti-onco - Gene? A Critical Review.- Activation of the Cellular p53 Gene in Friend Virus-transformed Erythroleukemia Cell Lines.- Analysis of Transcriptional Regulatory Regions of the Human p53 Gene in Human Cells Using an EBV-derived Shuttle Vector.- SV40 DNA Replication In Vitro.- Contributors.- Acknowledgements.


Best Sellers


Product Details
  • ISBN-13: 9783642741999
  • Publisher: Springer-Verlag Berlin and Heidelberg GmbH & Co. KG
  • Publisher Imprint: Springer-Verlag Berlin and Heidelberg GmbH & Co. K
  • Height: 242 mm
  • No of Pages: 477
  • Returnable: N
  • Width: 170 mm
  • ISBN-10: 3642741991
  • Publisher Date: 22 Nov 2011
  • Binding: Paperback
  • Language: English
  • Returnable: N
  • Series Title: 34 Nato ASI Subseries H:


Similar Products

Add Photo
Add Photo

Customer Reviews

REVIEWS      0     
Click Here To Be The First to Review this Product
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation: (34 Nato ASI Subseries H:)
Springer-Verlag Berlin and Heidelberg GmbH & Co. KG -
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation: (34 Nato ASI Subseries H:)
Writing guidlines
We want to publish your review, so please:
  • keep your review on the product. Review's that defame author's character will be rejected.
  • Keep your review focused on the product.
  • Avoid writing about customer service. contact us instead if you have issue requiring immediate attention.
  • Refrain from mentioning competitors or the specific price you paid for the product.
  • Do not include any personally identifiable information, such as full names.

Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation: (34 Nato ASI Subseries H:)

Required fields are marked with *

Review Title*
Review
    Add Photo Add up to 6 photos
    Would you recommend this product to a friend?
    Tag this Book Read more
    Does your review contain spoilers?
    What type of reader best describes you?
    I agree to the terms & conditions
    You may receive emails regarding this submission. Any emails will include the ability to opt-out of future communications.

    CUSTOMER RATINGS AND REVIEWS AND QUESTIONS AND ANSWERS TERMS OF USE

    These Terms of Use govern your conduct associated with the Customer Ratings and Reviews and/or Questions and Answers service offered by Bookswagon (the "CRR Service").


    By submitting any content to Bookswagon, you guarantee that:
    • You are the sole author and owner of the intellectual property rights in the content;
    • All "moral rights" that you may have in such content have been voluntarily waived by you;
    • All content that you post is accurate;
    • You are at least 13 years old;
    • Use of the content you supply does not violate these Terms of Use and will not cause injury to any person or entity.
    You further agree that you may not submit any content:
    • That is known by you to be false, inaccurate or misleading;
    • That infringes any third party's copyright, patent, trademark, trade secret or other proprietary rights or rights of publicity or privacy;
    • That violates any law, statute, ordinance or regulation (including, but not limited to, those governing, consumer protection, unfair competition, anti-discrimination or false advertising);
    • That is, or may reasonably be considered to be, defamatory, libelous, hateful, racially or religiously biased or offensive, unlawfully threatening or unlawfully harassing to any individual, partnership or corporation;
    • For which you were compensated or granted any consideration by any unapproved third party;
    • That includes any information that references other websites, addresses, email addresses, contact information or phone numbers;
    • That contains any computer viruses, worms or other potentially damaging computer programs or files.
    You agree to indemnify and hold Bookswagon (and its officers, directors, agents, subsidiaries, joint ventures, employees and third-party service providers, including but not limited to Bazaarvoice, Inc.), harmless from all claims, demands, and damages (actual and consequential) of every kind and nature, known and unknown including reasonable attorneys' fees, arising out of a breach of your representations and warranties set forth above, or your violation of any law or the rights of a third party.


    For any content that you submit, you grant Bookswagon a perpetual, irrevocable, royalty-free, transferable right and license to use, copy, modify, delete in its entirety, adapt, publish, translate, create derivative works from and/or sell, transfer, and/or distribute such content and/or incorporate such content into any form, medium or technology throughout the world without compensation to you. Additionally,  Bookswagon may transfer or share any personal information that you submit with its third-party service providers, including but not limited to Bazaarvoice, Inc. in accordance with  Privacy Policy


    All content that you submit may be used at Bookswagon's sole discretion. Bookswagon reserves the right to change, condense, withhold publication, remove or delete any content on Bookswagon's website that Bookswagon deems, in its sole discretion, to violate the content guidelines or any other provision of these Terms of Use.  Bookswagon does not guarantee that you will have any recourse through Bookswagon to edit or delete any content you have submitted. Ratings and written comments are generally posted within two to four business days. However, Bookswagon reserves the right to remove or to refuse to post any submission to the extent authorized by law. You acknowledge that you, not Bookswagon, are responsible for the contents of your submission. None of the content that you submit shall be subject to any obligation of confidence on the part of Bookswagon, its agents, subsidiaries, affiliates, partners or third party service providers (including but not limited to Bazaarvoice, Inc.)and their respective directors, officers and employees.

    Accept


    Inspired by your browsing history


    Your review has been submitted!

    You've already reviewed this product!